stgitskaysie3965 stgitskaysie3965
  • 20-08-2017
  • History
contestada

What was the name of the magazine that nineteenth century middle class women read to learn how to behave like a “true woman?”?

Respuesta :

texaschic101
texaschic101 texaschic101
  • 20-08-2017
I believe that it might be " Godey's Lady's Book."  The number 1 women's publication read by true women in the 19th century. It was an instructional magazine that taught women how to behave like True Women.
Answer Link

Otras preguntas

IM GIVING 20 POINTS PLEASE! I NEED HELP!
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
A bird flies at a speed of 4 m/s. It flies for 2160 seconds from its nest to the field. How much distance did the bird cover?
Target sells a watch for $99 and offers a 15% discount. Walmart sells the same watch for $59 and offers a 10% discount. Which store should you buy the watch fro
Poetry Means The World To Me 5.What is the effect of repeating "used" in line 15?
Explain why a scientist should or should not change a theory based on one experiment?
why teaching profession is important?​
how can we maintain empathy and cooperation in the society​
Which of these countries is further north? Select one: a. Argentina b. Costa Rica c. Colombia
Which of these is a Microsoft certification for system engineers