figueroamelany316 figueroamelany316

19-12-2020
Biology

contestada

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Respuesta :

raduoprea160 raduoprea160

19-12-2020

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer Link

Otras preguntas

Why is the title “Love in the Time of Cholera” significant?

PLS help..............

The most basic part of a word that retains meaning is called a:

When determining whether the evidence is substantiated or unsubstantiated, look to see if the claim is based on or not.

How did John Quincy Adan, treat Indigenous Americans?

The nucleus of the eukaryotic cell functions: A) as the command center for the cell B) to store the cell's hereditary information C) to house the nucleolus D) t

Read the sentence. The players, after a hard game played in the rain and mud, were tired and dirty, and they lumbered toward the locker room for showers. In the

The construction work is an annoyance for those working next door what is the suffix

what is negative 2/7 + 1/4 =

The process of mentally assuming the perspective of another, thereby enabling one to respond from that imagined viewpoint, is known as.