shanti20 shanti20

18-07-2017
Mathematics

contestada

2x-2y=4 -x+y=-2 does the system have one solution no solution or infinitely man solutions

Respuesta :

dejadotad1447 dejadotad1447

18-07-2017

no solutions, the equations have parallel slopes but different y intercepts meaning they will cross

Answer Link

Otras preguntas

what are the composite numbers between 40 and 50

2- Water flowing downslope without seeping in the ground is A. Runoff B. Lac C. Precipitation D. Groundwater 3- Conditions that determine whether the water will

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

Which of the following best describes apothecary? a. conversion of ore into gold b. preparation and sale of drugs and medicines c. removal of iron from iron

Prefixes change the _____ meaning of a word.

use a bright color to indicate the peninsula and islands of Greece

Your _____ is the number of times your heart beats per minute while it's at rest. Question 1 options: A) heart rate B) resting heart rate C) Maximum heart

rewrite this sentence to make it correct the Boston Massacre and the repeal of taxes under the Townshend Acts began huge protests across the colonies

Paquito y yo_________rubios. ,Paquito and _____ I blond. idk if it is: son=are es = is somos = we are or something else.

Until recently the disabled were actually penalized for finding a job because: a. they were paid less than other workers. b. they lost their Medicaid benefi