18-11-2016
Biology

contestada

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT
TACGCGACGTGCACGTGCAA MRNA-----

Respuesta :

18-11-2016

I believe A translates to U, T transtates to A, G translates to C, and C traslates to G.

ATGCGCTGCACGTGCACGTTTACGCGACGTGCACGTGCAA

mRNA

UACGCGACGUGCACGUGCAAAUGCGCUGCACGUGCACGUU

Answer Link

Otras preguntas

round off 318.90 to 2 significant figures

Answer in the affirmative.1 ¿Se prohíbe usar los teléfonos celulares en el trabajo?2 ¿Hay que hablar en español en clase?

A system with the same line has an infinite number of solutions. True or False

Find f(3) and find one value of x for which f(x)=2.

Which of the following are not polynomials? A. x² +2√x+1 B.x²+x+1 C. 2/3x2+x+1 D. x2+√2x+1 E. x-2+x+1

is the ban of slavery an example of loose constructionism or originalism

select all the con Choose the graphs that indicate equations with no solution. + 3x + 2 = −6(-ª) y A 4 -2 4+ 2 -2- 2 4 4 +x+ 8(-a) -4 -2 HE H у 14 2. 2. -2- -4-

Which part of the heating curve corresponds with the boiling of liquid water?

The graph is of a function in the form p(t) = a*b^t. What is the function?

what is the strategy when figuring out the IQR and the 5-number summary for the data