ttok77811 ttok77811

20-03-2022
Social Studies

contestada

How much of his paycheck should Trevor put towards his trip savings

Respuesta :

zubaelkash zubaelkash

20-03-2022

Answer:

30% of his paycheck should be put towards his saving

Answer Link

selinssblogg selinssblogg

20-03-2022

İ think 30% but im not sureeee

Answer Link

Otras preguntas

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

its true right? 2. Some road surfaces are more slippery than others when wet. A. True B. False

What part of a canal makes it possible for boats to go over hills? A) Turnpike B) Celeripede C) Lock

What is a metaphor using the color orange?

During the Gilded Age, the government passed legislation to: A.handle the great number of people living in cities B. Give the government ownership of new indust

what do ribosomes make?

The heart circulates blood through two pathways: septum and cardiac muscle. Aorta and left atrium. Tricuspid Valve and pulmonary valve. The pulmonary circuit an

In this sample body paragraph written with the Alternating Method, which evidence uses only paraphrases? A. Ulrich accuses Georg of being “caught poaching on a

What is he credited with creating

Which of the following statements uses the multiplicative identity? (A) (-8)(1) = -8 (B) -8 + 0 = -8 (C) (-8)(-1) = (-1)(-8) (D) -8 + 1 = 1 + (-8)