Seudónimo Seudónimo

17-11-2020
Mathematics

contestada

The speed of an object in space is shown in the graph. What is the slope of the line?
A. 10
B. 15
C. 20
D. 25

The speed of an object in space is shown in the graph What is the slope of the line A 10 B 15 C 20 D 25 class=

Respuesta :

jellygirl101 jellygirl101

17-11-2020

Answer:

I think it is B

Step-by-step explanation:

Answer Link

daijahnac32 daijahnac32

17-11-2020

Answer: B-15

Step-by-step explanation:

3 divided by 0.2 is 15

Answer Link

Otras preguntas

How do text features contribute to a text’s structure? Check all that apply.

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

describe what you would experienced or seen in the city of turpan

Which of the following types of energy does the Earth receive from the Sun?

Factor completely the polynomial. Please help ASAP! 6x^2-4x^3+10x^4

Calculate the eccentricity of an ellipse. The distance between the foci is 5.2 and the length of the major axis is 20.6.Round off your answer to the nearest tho

In an xy-coordinate system, Line l has a slope of –3. If the points (2, 16) and (5, t) are on Line l, what is the value of t? A.17 B.15 C.25 D.7

pls help pls pls pls pls pls pls pls pls pls pls

Strong muscles help support your joints and prevent injuries burn fewer calories buy larger clothes No answer text provided.

5 - 3 1/4 This is Fractions