3000347 3000347

16-04-2020
Biology

contestada

What happens to detritus in the ground? Why is this important?

Respuesta :

zayne7777 zayne7777

16-04-2020

Answer: Detritus is important to wetland ecosystems because it provides important nutrients for plant growth.

Explanation:

Answer Link

Otras preguntas

Упражнение 3. Учить, научить, учиться, научиться. Выберите глагол и поставьте его в нужную форму. 1. Ты хочешь ………хорошо плавать? Тогда приходи в бассейн! 2. Я

Paige has 1 ½ feet of rope for a project. She only needs 2/3 of it. How much rope does she need?

What is the equation of the line that passes through the point (-6, -7) and has a slope of o?

2. -7 +5m3 + 9m - 3m^2

what is 1/4(8+x+4) simplified using the distributive property

Please help fast I’ll give you brainless plus a bunch of points I need the whole radical

Olve for x. Check each step or answer that is correct. 34(x + 4) = 14(x + 8) (A) Distribute 34 on the left side of the equation. (B) Distribute 14 on the right

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

100 point giveaway! write numbers 1-100 for brainliest!

A 6.5 ft. Tall car, parked next to a truck, casts a 33.2 ft. Shadow. If the truck casts a shadow that is 51.5 ft. Long then how tall is the truck? Round to the