sharonnalyles sharonnalyles
  • 17-03-2020
  • Mathematics
contestada

Solve the system of linear equations by graphing
X+y=7
-x+y=-7

Respuesta :

emmakopp15
emmakopp15 emmakopp15
  • 17-03-2020

Answer:

Subtract x from both sides of the equation.

y=7−x

−x+y=−7

Add x to both sides of the equation.

y=7−x

y=−7+x

Create a graph to locate the intersection of the equations. The intersection of the system of equations is the solution.

(7,0)

Step-by-step explanation:

Answer Link

Otras preguntas

The main function of the muscular system is ____. Movement Heat Production Posture Sensory Input
Qu'est-ce que c'est qu'un panda? what is this in english? (its french) please try to avoid using google translate. I got "what is a panda" but i feel like thats
Thomas Hobbes was an Enlightenment thinker considered to be the originator of social contract theory. According to Hobbes and his ideas on social contract, whic
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
The experiments conducted by this scientist demonstrated the principle of biogenesis. a. darwin c. pasteur b. mendel d. redi
Please help I'm so confused
what is 1 8/9 written as a improperfraction
How can I concentrate while studying
Which of he following is not a part of the peer review process or its result? A. Allowing scientists to share ideas through published work B. Making sure that a
a blood cell is placed in a 1.5 percent salt solution. will osmosis, diffusion, or both occur across the plasma membrane? why?