raeva raeva
  • 18-08-2019
  • Mathematics
contestada

abcd is a trapezium in which ablldc
​

Respuesta :

anirudhkaithayil
anirudhkaithayil anirudhkaithayil
  • 18-08-2019

Answer:

Step-by-step explanation:

Draw OE parallel to AB and CD.

In  ABD, OE || AB

By Basic Proportionality theorem,

... (i)

In  CDA, OE || CD

By Basic Proportionality theorem,

... (ii)

From (i) and (ii), we get,

Or,  

Answer Link

Otras preguntas

1An aeroplane of mass 2.5 x 105kg lands with a speed of 62 m/s, on a horizontal runway at timet = 0. The aeroplane decelerates uniformly as it travels along the
You read 5 chapters of a book in 2 and 1/2 hours. How many chapters can you read in 1 hour?
A drag racing vehicle travels from 0 to 100 mph in 5 seconds north. What is the acceleration?
QuestionTwo bicycles have the following equations of motion, what is the distance between the bicycles at t = 0?X1= -6.0 m+ (7.5 m/s)X2 = 9.6 m +(-4.5 m/s)t​
Please answer this I just need the slope.
a town has a population of 16000 and grows at 2% every year. to the nearest tenth of a year, how long will it be until the population will reach 22900?
add. write the answers in descending order of the variable (7x^3 + x + 3)+(x^3 - 2x + 3)
Look at this poster from the Click it or Ticket Mobi zation Media Campaign What is the purpose of this poster? O to let people know that they will get caught i
answer fast............​
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT