lyndeejones lyndeejones
  • 19-03-2024
  • Mathematics
contestada

Merrily has found that the probability of randomly drawing a bag of green tea out of the box of assorted teabags, is one out of three, if Meryl draws 27 teabags out of the box, which of the following is the best prediction of the number of teabags, that will be green tea

Respuesta :

Otras preguntas

How do you say the word "say" in German
What is the measure of F? A. 30 B. 40 C. 20 D. 50
Which of the following would be a violation of the Americans with Disabilities Act? a. refusing to hire qualified applicants who have disabilities b. lack o
An amount of $8,000 is invested at a simple interest rate of 1.5%. What is the total amount after three years?
what is the caribeanislands major industry
If you want to increase the gravitational force between two objects, what would you do
Make This Division Sentence True: _____ / _____ = 25 Reminder 7
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
Describe how the lack of water in an environment can affect the amount of carbon dioxide absorbed by the plant.
beberapa ekor semut sedang menghurung bangkai seekor belalang yang terjatuh di atas sehelai daun kering pada sebatang kayu yang tumbang.Bangkai belalang tersebu