briancapers2548 briancapers2548

21-02-2024
Physics

contestada

If n is an integer, n⋅180° represents an integer multiple of 180° and (2n+1)⋅90° represents an odd integer multiple of 90° , and so on. Determine whether the expression is equal to 0,1,−1, or is undefined. sin[n⋅180°]

Respuesta :

Otras preguntas

Once swallowed , the food passes down into a long tube called the ___________ ( stomach / oesophagus ).

100 point giveaway! write numbers 1-100 for brainliest!

Help me!!!!!!!!!!!!!!!!!!!!!!!

A hotel charges $80 for the first night and $70 dollars for each additional night. How long can you stay at the hotel if your budget is $850 dollars?

A gannet flies 24 1/2ft above sea level. It increases its elevation by 5ft. Then it dives and changes its elevation by -47 2/3ft. After it dives, what is the ga

how do i find b in this

What problems will two decimal places have in the product? Select all that apply. A 7.5 × 10 B 6.3 × 3 C 3.2 × 4.7 D 5 × 0.85 E 5.47 × 100

how do you get over someone and not cry over them anymore?

What is meant by vital event? What kind of event areregistered in VRS?

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT