Chaos122 Chaos122
  • 17-05-2015
  • Mathematics
contestada

239.2 is 23 % of what

Respuesta :

vuvuong003
vuvuong003 vuvuong003
  • 17-05-2015
The formula is [tex] \frac{number}{100}= \frac{is}{of} [/tex].
In this case 239.3 is is and we don't know of because they said of what?
Plug the number in to the formula and we have
[tex] \frac{23}{100} = \frac{239.2}{?} [/tex]
Solve the problem by multiply 239.2 into 23 and we get 5501.6 as the answer 
Answer Link

Otras preguntas

A quality control manager is concerned about variability of the net weight of his company’s individual yogurt cups. To check the consistency, he takes a random
CRIMINAL JUSTICE Which of the following is true about long-term goals ? A) they requiere a lot of planning to achieve B) Their results are life-changing C) The
Which of the following terms are associated with over-the-counter (OTC) trading? 1. Market maker. 2. Specialist. 3. Auction market. 4. Negotiated market. A. 1 a
how are sound wave different from the waves in the sea or the ripples on water mark brainliest
The Port Huron Statement embraced 1960 s American political and social life as the best ways to organize government and society. a) true b) false
What was the purpose of Colombus writing his journal?
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC
solve the inequality for w. 11 ≤ w - 3
Solve for x in the simplest form 11=1/2x+8
I really don’t get this question can someone help me