nicole1798 nicole1798
  • 21-02-2017
  • Spanish
contestada

¿Cómo se cree que fueron formadas Las Islas Galápagos?

Respuesta :

Аноним Аноним
  • 21-02-2017
Estas se crearon concretamente por “el punto caliente”, situado Ecuador terrestre en la placa de Nazca 
Answer Link
juanjoesgarza juanjoesgarza
  • 21-02-2017
se formo por el cambio de la tiara que iso que se apartaran de sur America
Answer Link

Otras preguntas

Two identical spheres (of equal mass) a distance of 10 meters apart exert a force of gravity of 0.00050 N on each other. What are their masses?
Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACCCCTGACTTCGCGCCGTCG(39) (a) What
I need help with these reasons for geometry. :)
Find the volume of this figure to the nearest whole number. Use 3.14 for a pie .
The formula for the volume V of a cylinder is V=pier2h, where r is the radius of the base and h is the height of the cylinder. Solve the formula for h.
I'll give you the brainly thing.The 14th Amendment guaranteed African Americans “equal protection” and the 15th Amendment established black male suffrage. Expla
A fox can run at a rate of 62 miles in 2 hours. A rabbit can run at a rate of 22 miles in 30 minutes. Which animal has the faster speed in miles per hour?
A 20-kg dog on ice skates is accelerating at 2 m/s2. What is the net force on the dog?
heterotrophs obtain energy by ____ (starts with an f)​
in which type of bond are atoms held together like magnets?​