Why did industrialization change the economy of how many countries? Check all that apply

Question

17-02-2022
History

contestada

Why did industrialization change the economy of how many countries? Check all that apply

Respuesta :

Otras preguntas

How were the Reconstruction plans of President Abraham Lincoln and President Andrew Johnson similar?A.Both gave employment opportunities to former slaves.B. Bot

Which equation has the components of 0=x^2-9x-20

In the game of roulette, a player can place a $4 bet on the number 23 and have a StartFraction 1 Over 38 EndFraction probability of winning. If the metal ball

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d

major types of natural resources in India. According to the map above, there are A 4 B. 5 C 10 D. 16 Please select the best answer from the choices provided

Change 3.52 radians to degree measure. Round to the nearest tenth. a. 381.70 C. 201.70 501.70 d. 291.7 b.

A random sample of 45 door-to-door salespersons were asked how long on average they were able to talk to the potential customer. Their answers revealed a mean o

Write each equation in standard form.18. y = 4x - 519. y - 3 = 5(4-X)

5. How could you increase the power of a wave in a spring?

containmentformyexis containmentformyexis · Answer 1 · 2022-02-17T10:21:45+01:00

containmentformyexis containmentformyexis

17-02-2022

The correct answers are A) individuals began to start more private business, C) new banking systems financed the growth of business, and D) factories began to employ specialized workers

Answer Link