Ad2e6ltonCassasak Ad2e6ltonCassasak

19-12-2016
Physics

contestada

What is the leading cause for change between states of matter?

Respuesta :

mathssydney mathssydney

19-12-2016

Change of energy (normally potential energy via temperature change)

Answer Link

Otras preguntas

what ia 10 + 10 -10 x 5932

A(n) _____ reaction is a reaction in which an acid and a base react in an aqueous solution to produce a salt and water.

In what region of the united states were most of the nation's cities located by the 1850s

the circumference of a circular stage is 157 feet. if katie paints the stage at the rate of 400 square feet per hour hownlong would it take, to the nearest hour

Rearrange the formula for the kinetic energy, K = \frac{1}{2} m v^2, to isolate v, the velocity.

I'LL GIVE BRAINLIEST FOR YOUR OPINION!The cheapest mode of transport in Paris is still the vélib! But what is it and how does it work? Go to the vélibs website

Organisms that must eat food for energy are _____. multicellular heterotrophs macrophages photosynthetic

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

The 8 red markers in a package account for 4% of all markers in the package. How many markers are in the package? Enter your answer in the box.

Put these greenhouse effect events in order, starting with light's origin. Earth radiates longwave radiation. Longwave radiation is blocked and heats