kcsushrika99
kcsushrika99 kcsushrika99
  • 19-07-2021
  • English
contestada

English grammar please help ​

English grammar please help class=

Respuesta :

SnehaJoshi
SnehaJoshi SnehaJoshi
  • 19-07-2021

Answer:

I guess the answer is 'd'

Answer Link

Otras preguntas

help me plz plz....​
Larkspur Co. had cost of goods sold of $3,100. If beginning inventory was $3,200 and ending inventory was $1.050. Larkspur's purchases must have been:__________
what is the displacement if you walk 100m north, then 200m south, then 300m north ​
What is the distance between point (6, -1) and point (5, 3) rounded to the nearest tenth?
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC
Simplify 7.5 + n + 9.63.
Companies like GE have committed significant resources to develop products that meet the needs of developing nations, products that deliver just enough adequate
What is 5 ∙ P ∙ 2 Simplified?
south America is economically entirely based on natural resources and minerals how ​
Consider the following information: Observations 1 2 3 4 5 6 Num. of defects 10 18 13 15 9 12 The number of runs above and below the sample median is:__________