Sjdjcjd272727 Sjdjcjd272727

16-11-2020
History

contestada

Help ASAP!! Which phrase best describes the structure of the executive branch?

Help ASAP Which phrase best describes the structure of the executive branch class=

Respuesta :

nerofirespitter990 nerofirespitter990

16-11-2020

Answer:

c

Explanation: Becuase they execute the laws

Answer Link

Otras preguntas

The initial vertical velocity of a rocket shot straight up is 42 meters per second. How long does it take for the rocket to return to Earth? Round your answer

Which set of statistics best described a typical home value in Maya's neighborhood and how the values vary?

How does the Mexican ambassador react to Roosevelt corollary

Which process is the one in which glucose is oxidized to generate two molecules of pyruvate and in which atp and nadh are produced?

A student's pay of $18 an hour is $4 more than twice the amount the student earns per hour at an internship. Enter and solve an equation to find the hourly pay

All of the following are a change from a more condensed to a less condensed state of matter except (2 points) condensing boiling evaporating melting

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

if the output is 21, what is the input ?

Imagine that it’s the last day of high school and you’ve been asked by a teacher to say a few words that summarize the events that have occurred over the last

In order to determine the most popular ride at Cedar Point, a researcher interviewed people in the parking lot as they were leaving Cedar point. Assuming that e