pettus202588857 pettus202588857

16-11-2020
Mathematics

contestada

12 + 6r less than or equal too 3(5 + r) for r

Respuesta :

suniltamang123123 suniltamang123123

07-12-2020

Answer:

LLOOOL

Step-by-step explanation:

Answer Link

Otras preguntas

Which is not a basic function of a cell ? a. Obtaining energy b. Storing energy c. Destroying energy d. Releasing energy

Which of the following contradicts Tocqueville’s understanding of egalitarianism:

I need help with this and please show your work

A 1.00 L volume of HCl reacted completely with 2.00 L of 1.50 M Ca(OH)2 according to the balanced chemical equation below. 2HCl + Ca(OH)2 mc013-1.jpg CaCl2 + 2

How does the autonomic nervous system differ from the somatic nervous system?

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

Which of the following is an autotroph? A. A prey B. A predator C. A producer D. A consumer

during which time period were artists keenly interested in using the golden ratio in their paintings? a. baroque period b. oriental period c. futuristic period

most traditional Bolivian music usually include

Simplify (tan(θ)+cot(θ))/(sec(θ)•csc(θ)) completely