jackiemoreno2868 jackiemoreno2868
  • 20-08-2019
  • Geography
contestada

Which of the text's major theoretical perspectives would consider urban sprawl as a benefit for society because it allows and supports population growth?

Respuesta :

bratislava bratislava
  • 26-08-2019

Answer:

Benefits Job growth and Housing development

Explanation:

As Urban sprawl is land use phenomenon its more based on car dependent communities, also this process leads in increase in development of housing as increase in urban living and increase in consumer preferences, and development of means of travel. Urban planning also improves as of this population growth.

Answer Link

Otras preguntas

What do you think is the most important political issue at the moment?
HEELPPP YALLLL PLEASE
If an airplane is flying east at 500 mph into or against a head wind that has a speed of 20 mph. What is the net velocity of the plane.
Tracy, a political campaign organizer, realizes that the number of hours needed to get out a mailing for her candidate is inversely proportional to the number o
What is the description method of sinigang? (Description method set)
Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
What does the expression 4x² + 4y2 + 8xy show that is not in 64x2? What information is in 64x² that is not in 4x² + 4y² + 8xy? Explain your reasoning.
I NEED SOME HELP KIND PEOPLE :(
The equation y = 0.4x can be used to predict the number of hours, y, it takes Zula to write x number of articles for a newspaper. Which of these is the best int
when using a direct quote, you must include the location of the quote as part of your in-text citation.