darrenjones5253 darrenjones5253

20-04-2019
Physics

contestada

Which gas molecules have the highest average kinetic energy at a given temperature?

Respuesta :

Аноним Аноним

20-04-2019

Answer:

Some gases like HBr, NO2, C2H6 all have the same kinetic energy.

Explanation:

Answer Link

Otras preguntas

Why does Edwards use the word provoked instead of the word angered in this passage? The word provoked suggests that God’s anger is fierce and irrational. The wo

The Kelvin temperature of the hot reservoir of an engine is twice that of the cold reservoir, and work done by the engine per cycle is 50 J. Calculate: (a) th

Arrange the following substances in the order of increasing entropy at 25°C. a. HF(g) b. NaF(s) c. SiF 4(g) d. SiH 4(g) e. Al(s)

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

When you write your main idea as a statement, it should be: a) no shorter than a full essay length b) no shorter than one or two pages c) no longer than one or

In an introduction of yourself, write about what you believe is “the highest calling of your heart” and what you will “stand up for” because you so “truly belie

Sample size is not an important consideration when planning research and evaluations. True False

On most points along a short run phillips curve, expectations of inflation are generally:_______ a. greater than actual inflation because people tend to overre

What is a Spontaneous charge

what are the photoautotrophs?