saraderrico saraderrico

17-04-2019
Mathematics

contestada

can you find the constant proportionality when given a certain situation

Respuesta :

janthony36 janthony36

17-04-2019

Answer:

yes

i am truly sorry if this is not the answer you are looking for i am just a bit confuzzled with your question

Answer Link

Otras preguntas

Find the length of the midsegment of the trapezoid with the vertices A(0, 3), B(2, 5), C(6, 4), D(2, 0).

____ is portion of the nervous system that controls smooth muscle.

The origin of the Spring Festival？

Help plsssssssssssssssssssss

Which of the following best completes this sequence of events? Responses A The Northwest Ordinance opens land for American settlementThe Northwest Ordinance ope

Broadcasters use a parabolic microphone on football sidelines to pick up field audio for broadcasting purposes. A certain parabolic microphone has a reflector d

Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

how is the executive branch related to the legislative branch

In a physics lab experiment, a spring clamped to the table shoots a 19 g ball horizontally. When the spring is compressed 20 cm, the ball travels horizontally 5

2. Resume los requisitos que tiene que cumplir Ildara para poder forjarse el futuro que desea, lejos de su vida actual.