farhanabadar86 farhanabadar86

19-03-2024
Biology

contestada

An mRNA codon for the amino acid Alenine is GCC. How many Alenine molecules are present in polypeptide containing 8 amino acid code for, the following DNA template
TCGGCCTACCGGGCCCATGCCAAT

Respuesta :

Otras preguntas

What are some superstitions or irrational fears that cause people to make false accusations today?

What is the formula of a rhombus?

A park ranger is looking out from their station at a 30 degree angle , angle of depression. The ranger is 80 feet above the ground.how far is it from the ranger

I need to no the answer to this question

how are tornadoes categorized

Describe Ms word environment.

What condition is required for fermentation to occur?

What is the effect on the graph of the parent function f(x)=x when f(x) is replaced with f(x-7)

This table shows how many sophomores and juniors attended two school events. A student is selected randomly from this group.

Need help on checking my answers! The ones circled in yellow are the ones that I believe the answers are. Please and thank you