sharidler sharidler

16-12-2022
Biology

contestada

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Respuesta :

Otras preguntas

is this a run on sentence ? does anything need to be changed ? The rainforests of Puerto Rico soothe the visitor with lush vegetation, a cool mist, and, occasio

rosa has 16 unit cubes. how many different rectangular prisms can she build with the cubes?

Francis is buying a stereo system for $196. She wants to pay for it in four equal monthly installments. what is the amount she will pay each month

how many 9 go into 67

Which word is the conjunction in this sentence? Priscilla put the soccer ball under the tree and ran into the house. A. and B. put C. into D. under

what are some characteristics of warm and cold air?

12. Typically, entrepreneurs don't like to be told what to do because A. they're stubborn by nature. B. it takes a big ego to run a business. C. they have pr

24 is 30% of what? Help

1.Rachel has 6 pairs of black shoes and 2 pairs of red shoes. What is the ratio of pairs of red shoes to pairs of black shoes? A. 3:1 B. 1:3 C. 4:1 D. 1

why do some countries allow little freedom ?